How to visualize generated RNA secondary structure

I'm working on a tool to visualize RNA secon开发者_运维问答dary structure, for this purpose I have implemented Nussinov's algorithm which generates the RNA secondary structure as list with the corresponding indices, the code can be found here [0]

[0] http://dpaste.com/596262/

But I really stuck with understanding how I should visualize it (as a planar graph), the code above gives me a sequential list of the secondary structure, so can someone please suggest me as to how I can visualize the structure.An example of such tool can be found here [1]

[1] http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi

and I know there are better algorithms but for now I would just want to visualize with this and once I understand visualization, I will go for a better algorithm.

Visualizing the secondary structure of RNA (or any graph, for that matter) algorithmically is a difficult problem. You need to take care that there are as few overlaps as possible while maintaining consistent link lengths. As the other answers have pointed out, there are a number of existing implementations that you can already use. I'll just throw in another one that's quite easy to use and requires no downloads:

forna - nibiru.tbi.univie.ac.at/forna

Here you just need to enter a dotbracket string:

>molecule_name
CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
((((((((((..((((((.........))))))......).((((((.......))))))..)))))))))

This will give you a visualization that looks something like this:

This is computed using a combination of the ViennaRNA RNAplot program and d3's force-directed graph algorithm.

You could do this with jmol . Jmol allows you to add arbitrary bonds / atoms to a coordinate space using its java or I believe its javascript api also.

In general, of course, PDB file formats would be used for such data.

RNAviz is old but still commonly used. JalView apparently was supposed to get RNA secondary structure rendering thru a GSoC project last year, but I'm not sure what the status in the program is.